Photography > More Photography

Genomic Medicine: A Prologue

The Human Genome Project was supposed to be the lunar landing of my generation. By spelling out the 3.2 billion chemical letters that make up our DNA, we were going to gain new insight into how our genes both cause and prevent disease. Once the genetic origins of cancer, heart disease, diabetes and Alzheimer’s were understood, scientists would be able to delve into our genes and fix our faults using gene therapy, ridding mankind of disease forever. Considering that nearly every human disease has a genetic root, genomics-based medicine was no small promise.

Not only was genomic medicine going to cure mankind, it was also going to cure our ailing healthcare system. In our 21st century, the days of familiar doctors, personalized care and affordable medicine seem a distant memory. Modern healthcare has become a trillion dollar industry where insurance companies dictate which doctor you can see and what kind of treatment, if any, you can afford. Patient care comes last in the big business of money-driven medicine. Genomic medicine, tailored to the unique genome of each individual, promises a return to patient-focused medicine and more efficient, more affordable healthcare.

Five years after all those Human Genome Project promises, very little progress has been made towards the genomic revolution. The road to genetic health has been repeatedly blocked by a tangle of political, ethical, and social-policy issues that threaten to keep genomics research stalled on the lab bench, far from patients. Knowing the letters of the genome doesn’t tell you much about the genes themselves, where they are, what they do or how to fix them. Answers to these technically difficult medical problems are hard to come by, while answers to thorny ethical questions and complex social problems sometimes simply don’t exist.

These issues are daunting, but not intractable. A small medical clinic in Strasburg, Pennsylvania is solving them everyday. At this clinic, hype and politics are pushed aside and genomics gets put to practical use in everyday patient care. By operating under special circumstances, thanks to its special clientele, the Clinic For Special Children is one of the few places in the world where genomic medicine is living up to its big promises.

Genomic Medicine: A Prelude

“The next frontier of genomic medicine is the everyday practice of
caring for the patient.” –D. Holmes Morton, M.D.

“The secret of caring for the patient, is caring for the patient.”
–Francis Peabody, M.D.


Emma Yoder is dressed just like her mother- white bonnet; handmade black dress; no buttons, just straight pins; and shapeless black shoes. Even the blond wisps of hair peeking out in front of her organdy bonnet are parted and braided like her mom’s. At four years of age, she looks just like a miniature adult, but there is no way of knowing whether Emma will ever get to grow up. Emma and her two brothers, dressed just like their father are all blind, deaf, and autistic, the victims of an undescribed, undiagnosed genetic disease.

Despite the kids’ formidable disabilities, this is a happy family. The parents, Amos and Fannie, are Old Order Amish and they believe their children – their special children as they call them – are gifts from God, sent to teach them about love and compassion. They are learning their lesson well; I feel no sorrow in this room, only delight in happy children. Emma has never learned to walk or talk, but what she can do is play patty-cake. Her Dad takes her small hands in his coarse farmer’s palms and gently pats them together. Emma grins, despite never having seen a smile; giggles, despite never having heard a laugh and claps her hands together again and again. This is her favorite game; her only game and her parents play it with her constantly.

Emma’s older brother, Ivan, doesn’t play patty cake, but if you reach out and touch his hand he will seize your finger with unsuspected strength and shake your arm up and down and all around, laughing. Ivan and Emma get a kick out of such simple contact. In a world they cannot see or hear or understand, anything they can sense they find delightful. Little Jacob lies quietly, his arms and legs too still for a baby. His blind eyes rove constantly, searching for some input. It is hard to say how much these kids can see- their eyes are blinded by retinal degeneration, but Fannie thinks a little light makes its way through. She says they know when it’s completely dark; they fuss without a nightlight, just like most kids do.

The Yoder family has come to the Clinic For Special Children today in their horse-drawn buggy for a checkup and to have some more blood for drawn for more tests. So far we know their mysterious disease affects their brains and their hearts, but we don’t yet know how or why. That’s why I am here today. I’m searching for the one the gene mutation among billions of bases of DNA that has robbed these kids of so much. I am trying to find a needle in a hayfield. If I can find it, the gene may lead to a treatment: medicine to supplement some chemical their bodies cannot make, or a special diet to exclude a protein they cannot break down. At the least we might be able to design a test to diagnose other kids with this disease, but for now we know only of these three siblings. Their mysterious disease is named for them: Yoder dystonia.

I explain to the parents what we are doing in the lab to find their kids’ faulty gene, try to convey how vast the genome is and not give them false hope for a miracle or a cure. They nod and listen and play patty cake with Emma as I talk. One of them is always softly touching Ivan and the baby, giving them an anchor in their dark, quiet world. For people who eschew technology and have only an eighth grade education, Amos and Fannie ask amazingly insightful questions about genetics. They are curious about this disease, where it came from and whether it will affect other children in their family. Remarkably, I get no sense of desperation from these parents, no frantic search for answers. They truly love their kids just the way they are, the way God made them and are enchanted with their simple happiness. When I get up to leave, the mother bids me to take a plate of homemade cookies she has brought; somehow in the midst of caring for three severely disabled kids, she has found the time to make me cookies.

As I head down the short hall to my humming laboratory, cookies in hand, I wonder how many other lab technicians have the opportunity to actually meet the patients whose genes they come to know so well. In our country’s increasingly specialized and faceless medical system, samples for testing usually arrive in biohazard envelopes, marked with a surname or a number. There is no person to consider, only some blood in a vial. Indeed, the Clinic For Special Children is unique in the world of medicine and not just because it was raised by hand in a cornfield and has hitching posts in the parking lot. The clinic is a place where parents and lab technicians, geneticists and pediatricians work together to study disease up close, on a day-by-day basis. By unraveling the intricate relationships between genes and environment, the body and disease, we gradually come to understand complex illnesses like Yoder dystonia. Such knowledge is then used to care for each child practically, effectively and at low cost.

The Clinic For Special Children was founded in 1989 by my parents, Holmes and Caroline Morton, to care for Amish and Mennonite children with rare genetic disorders. The plain people famously shun modern conveniences and technology but perhaps because of their high incidence of illness, they accept modern medicine as long as it is affordable and accessible. Unfortunately, healthcare often fails miserably on both counts. The Amish do not accept government help and thus don’t have any form of medical insurance. They pay bills out of pocket, in cash and are not permitted by the church to have outstanding debts. When a family cannot cover a bill, a collection plate is passed around at church and every family donates as much as they can to what they call “Amish Aid”. Hospital bills can soar into the tens, if not hundreds of thousands of dollars, ruining families and entire churches. Simple accessibility is also a problem. The Amish do not own cars and get from place to place in steel-wheeled horse-drawn buggies. Hospitals are often located in urban centers, far from farms and just getting to see a doctor can be a logistical nightmare.

Glutaric aciduria

The inspiration for the clinic came from a gravely ill Amish boy named Danny Lapp who perplexed doctors at the Children’s Hospital of Philadelphia (also called CHOP) until my father, a pediatric resident, diagnosed him with glutaric aciduria type 1. At the time, GA-1 was thought to be exceedingly rare, but Danny’s parents informed the doctors otherwise; they knew dozens of other Amish children who were sick just like their son. My dad took a day off from CHOP, drove two hours to Lancaster County and began knocking on farmhouse doors. In that single trip he more than quadrupled the number of known GA-1 cases in the world.

One of the first families he visited was the Millers. Amos and Susie had seven children, five disabled by GA-1. Two had died young and the other three were physically devastated. Susie remembers Amos nearly shut the door in my dad’s face, “He thought he was a salesman and it was dinner time”. But once my dad explained he knew why their kids were sick, he was invited in to eat with the family. Susie still gets tears in her eyes when speaking about that first meeting. “That was the first time a doctor had ever given us answers. My hands were shaking and I just couldn’t eat,” she recalls.

Glutaric aciduria results from the body’s inability to break down and excrete two proteins we all get from a regular diet, lysine and tryptophan. Normally, lysine and tryptophan are digested into safe molecules that can easily be expelled from the body. This breakdown is interrupted in glutaric aciduria by a mutation in a gene called GCDH and lysine and tryptophan are degraded into glutaric acid, which cannot be excreted. Babies with the mutation are born healthy, but after a few weeks or months the accumulation of glutaric aid reaches toxic levels in the brain, leading to a sudden and massive stroke. If they survive the stroke, the child is left brain damaged and profoundly handicapped for life.

Toxic levels of glutaric acid make certain areas of the brain weak and susceptible to stroke, but the stroke itself is actually triggered by prolonged periods of fasting. When a baby doesn’t eat for several hours, the brain runs out of glucose for energy and starts breaking down other kinds of sugars. This metabolic change seems to be what triggers the stroke, although we don’t yet know how or why. Glutaric aciduria is most dangerous during common childhood illnesses like a cold or chicken pox. If a child is sick enough to stop eating, they must be admitted to the hospital immediately for an IV glucose drip to protect their fragile brain.

During that first housecall, Susie Miller recounted to my dad how her five children were crippled. Each had a minor cold at the time and after putting them down for a nap, she found them unresponsive a short time later. GA-1 spares the thinking areas of the brain, but devastates the regions that control muscle movement. Sylvan and Levi lived only a few more months after their strokes. Levina and Alvin lost their ability to talk, crawl and sit up. Ten years later, they are unable to stand, let alone walk. Their limbs spasm constantly and painfully; Stevie especially is prone to seizures. Children with GA-1 are constantly agitated and fussy, which doctors thought might indicate a personality disorder. My dad believes it stems from sheer frustration. These kids are often very bright, but the stress of being trapped in bodies they cannot control wears on them greatly. They are difficult children to raise and require constant care.

Glutaric aciduria is just one of 105 inherited disorders that plague the Amish and Mennonite communities. Dwarfism is also common as are immune deficiency diseases. Many disorders are similar to GA-1 in that they result from mutations in genes that regulate the breakdown of proteins in the body. All of these disorders are also found the general population, whom the Amish call “the English”, but in a much lower frequency. For example, glutaric aciduria occurs in 1 in 200,000 English births; in the Amish it’s 1 in 200.

Driving away from that first house call at the Miller’s farm with an old fashioned doctor’s bag full of blood samples, my dad knew he would leave Philadelphia and move to Lancaster County. He had found was he was looking for in medicine – the opportunity to study disease up close. In Philadelphia he rarely saw a patient more than once. “I was one of hundreds of doctors at CHOP. I wouldn’t be missed there,” he recalls, “but those kids needed somebody to look after them; their families needed some answers. I don’t remember making a decision to come to Lancaster. It was a calling and I didn’t think twice about it”. My mother agreed with him immediately, despite having three young children between the ages of 1 and 5 and a mortgage. A Red Cross veteran, she had studied non-profit administration at Harvard and inherited an abiding interest in medicine from her father, a coal-country doctor in West Virginia.

My parents spent a year putting all of their efforts into applying for a National Institutes of Health grant for funding, only to be rejected. My dad’s teachers and supervisors were discouraging and warned him he was committing career suicide. Then, a writer at the Wall Street Journal caught wind of the story and wrote a front-page article about the Miller family and the need for an Amish healthcare clinic in southeastern Pennsylvania. The response was overwhelming: as soon as the paper hit the newsstands contributions from all over the country filled our mailbox, offering to pay for everything from money to lumber to a mass spectrometer. The following year a timber-frame clinic was built in the tradition of an Amish barn raising by many volunteer hands.

Ruthie

The Clinic For Special Children was built well off a country road, in the middle of a donated cornfield, in the heart of Pennsylvania Dutch country when I was seven years old. Most of my childhood was spent at the clinic, playing in the lab, in the halls, in the surrounding fields and woods. Amish families are large and I had an endless stream of kids to play with. Most of the patients were too sick to play; often severely physically disabled and confined to wheelchairs, they’d watch while their brothers and sisters and I ran around.

Because the Amish travel by horse and buggy, my dad makes a lot of housecalls. When I was young, one of my favorite families to visit was the Allgyers. Ruthie Allgyer was one of his more demanding patients so we’d make the drive out to their dairy farm a few times a month. Oftentimes, dad would go on to his next housecall and leave me at the farm for the day. Sadie Allgyer and I were about the same age and we would spend hours feeding newborn calves in the dairy barn and chasing kittens in the hayloft. At dinnertime, Mrs. Allgyer would ring the big bell on her porch, summoning her husband, ten children and me from our work and play in the barn and fields.

The Amish don’t use electricity and their houses are lit by bright, noisy kerosene lanterns. When we ran inside for dinner, Sadie would always stop and kiss her older sister Ruthie, who was usually sitting at the edge of the kitchen lamp’s light, supported by numerous pillows in her oversized wheelchair. We would all take our places on long wooden benches around the table and bow our heads for a silent prayer. Ruth couldn’t eat from the table; she took all her meals through a tube, but her chair was always wheeled up alongside the rest of us. I’d steal glances at her, trying to smile and nod and remind myself Ruthie was a person, trapped inside a wretched body.

When I was ten, Ruthie was in her twenties, but she weighed only thirty-five pounds. Her withered limbs were always tense; her useless hands stiff and claw-like. Severe scoliosis had grotesquely distorted her spine. Ruth could only move her eyes and make soft noises by blowing through her teeth. More often than not, tears were rolling down her upturned face. Ruthie endured her agony quietly.

This was glutaric aciduria at its worst. Like the Miller children, Ruthie had just been learning to walk when she got a cold, had a stroke and suffered a severe brain injury. Since that day she has been completely dependent on her mother for all of her needs; she cannot sit up, speak, move voluntarily, or swallow. Ruth’s physical injury is profound, but she is still in there: If you ask her a question she moves her brown eyes up for yes and down for no. Tell a joke and those eyes crinkle into a smile.

Ruthie is not the only Allgyer child with glutaric aciduria. Her sister Katie has the disease, but was somehow miraculously spared brain damage. She is the only healthy GA-1 survivor born before the clinic was started. The Allgyers had no idea Katie was also affected with Ruth’s disease until my dad went to their farm, on that first trip to Lancaster County, and took blood samples from the whole family. Katie’s diagnosis astonished everybody since she was completely asymptomatic. My dad reasoned that if Katie could escape injury, then other children could too: glutaric aciduria might be a treatable disease. He decided the most important key was to start treating these kids before they got sick. Once they fell ill and their developing brains were damaged, they were disabled for life. But if he could identify children soon after birth, before their faulty genes began to wreak havoc, then he might be able to keep them from going into crisis. If he could find them while they were still healthy, he might be able to keep them well.

Soon after the clinic was built, my dad began running a screening program to test all Amish and Mennonite newborns for glutaric aciduria and several other inherited diseases. During an Amish birth, the midwife (most Amish births take place at home) will take a sample of amniotic fluid as soon as the mother’s water breaks and have it couriered to the clinic for genetic screening. Within a matter of hours the fluid is tested for as many as 26 different genetic disorders, often before the baby is born. For the devoutly religious Amish and Mennonites, terminating a pregnancy is not an option, so the clinic does very little genetic testing during pregnancies. However, many newlywed couples have carrier testing done to determine whether their future children may be at risk for an inherited disease. The Amish do not use carrier testing results to arrange marriages nor do they decide against having children in light of a positive test. They believe their fates, and the fates of their children, are in God’s hands.

After they were married, Sadie Allgyer and her husband were both tested and found to be carriers of the GA-1 mutation. Their first daughter, Anna Rose, was born with glutaric aciduria in 2006. Anna Rose was diagnosed at birth and started immediately on a low protein formula to prevent the build-up of glutaric acid in her brain. Sadie was told to feed her formula every two hours and not to nurse. As Anna Rose grew, calories, essential amino acids, carbohydrates and vitamins were gradually added to her formula to create a balanced diet. She began eating solid food around the same time as other children, but she can only have a maximum of 2 grams of protein a day so her diet is restricted to low-protein foods.

I saw Ruthie in September of 2007 at the clinic’s annual benefit auction. She is now 34 and one of the clinic’s oldest survivors. Her mother, Linda, held Ruth in her lap while we sat and talked. I said, “Ruth, do you remember me?” and her eyes flicked skywards. I asked her mother about Ruth’s sister with whom I had caught kittens all those years ago. She told me Sadie is married and has children of her own. I said, “So you’re Aunt Ruth now?” Her eyes found mine immediately and shone with a proud smile.

A comparison of Ruth and Anna Rose’s medical charts shows the stark difference early diagnosis can make in the life of a child with glutaric aciduria. Ruth’s chart occupies two four-inch binders. Filled with hospitalizations, surgeries, and medical emergencies, Ruth’s charts document a lifetime of suffering. Anna Rose’s chart fits neatly in a manila folder. Her labs section is the heftiest part since she has her glutaric acid levels tested every few weeks to make sure her levels aren’t spiking. Also included in Anna Rose’s chart are photocopies from her mother Sadie’s diary. Sadie has recorded every feeding, every runny nose, every milestone Anna Rose has ever had. Anna Rose will be two this August, a very important milestone. Brain injuries always seem to occur before the second birthday. If Sadie’s daughter can stay healthy through August, she will be spared her Aunt Ruthie’s fate.

Joseph

Despite remarkable progress, glutaric aciduria is a battle not yet won. Before the clinic was established, 99% of children with GA-1 suffered the stroke between 3 and 18 months of age (with the one exception of Katie Allgyer). Even with the strict diet and rigorous monitoring, a few children with GA-1 still sustain brain damage in early childhood. Joseph Esh was one of these children. I never met Joe; he lived with his parents and four siblings in a small Amish settlement in Wisconsin, but after he died, I held his brain in my hands.

Joe had glutaric aciduria, as does his sister Ava. Their brother Mark had phenylketonuria (PKU), another genetic disease affecting the metabolism. The fact that Joe’s parents both have the mutations for two very rare genetic diseases is a testament to the Amish community’s limited gene pool. The chance both Joe and Mark would die on the same day from their respective diseases was even slimmer, but that happened too. Because of this unusual circumstance, authorities in Wisconsin insisted on autopsying the boys. The Amish adamantly refuse autopsies, preferring to prepare the body themselves for an open casket wake and burial. The coroner agreed to open only one of the boys and leave the other alone if the findings were consistent with natural causes. He picked Joe. In their grief, Joe’s parents asked my dad how the autopsy could help other children with glutaric aciduria. My dad asked for Joe’s brain.

A few weeks later I found myself in the morgue of Lancaster General Hospital with an unusual assortment of people: two pediatricians, a radiologist, a pathologist and, floating in a white plastic bucket, Joe’s brain. This was the first time a brain from a child with glutaric aciduria was ever dissected. My dad and Kevin Strauss, the clinic’s second doctor, were hoping to gain some insight into why Joe had had a stroke, despite the benefit of early diagnosis and treatment. Julie Mack, a neuroradiologist and expert in diagnosing glutaric aciduria on MRI scans wanted to see such a brain in the flesh. Jim Eastman was the head pathologist at Lancaster General and glad to have such an interesting case on one of his morgue’s metal tables.

This was my first human brain (I had dissected a shark and a sheep brain in college) but my colleagues had seen this extraordinary hunk of snaking, noodley flesh many times before. Even so, we all took a collective deep breath as Kevin lifted the brain from the bucket and placed it on a scale. From the reverential silence in the room, I gathered that nobody ever really gets over seeing a human brain. I stood there eyes wide, trying to wrap my mind around the remnants of the one before me. The brain was dense and robust and seemed capable of harboring great secrets. But at the same time, I couldn’t help but think- shouldn’t it be bigger? Where are all the wires?

Joe’s brain was heavy, heavier than most adult brains, highly unusual for a fourteen year old. It wasn’t bloated or swollen in any way. It was just big and other than some slight serrations on either side where a circular saw cut away the skull, it was intact and perfectly preserved. We had already spent several hours that morning constructing our game plan, planning the series of slices to best access the areas we wanted to see. Kevin picked up a knife – a large, sharp knife – and deftly cut the brain in half down the center fissure, separating the left and right hemispheres. He must have heard me holding my breath for he looked up at me smiling and said, “Like a hot knife through butter!”

Kevin is a pediatrician by trade, but he has a gift for neuroanatomy. To the untrained eye the brain is a convoluted tangle of indiscriminate tissue. The lines and distinct boundaries printed so neatly in Gray’s Anatomy aren’t really there. On one half of the brain we cut slices from the top of the brain to the bottom; the other hemisphere, we cut slices from one side to the other. This way we would be able to see structures in both halves of the brain from different angles. In mapping a region for dissection, Kevin used touch as often as sight, feeling his way across the brain, his fingers seeking areas a little tougher or a little softer than the rest. He told me to feel for myself, so I placed a gloved finger on a lobe. I was surprised. The brain wasn’t jello; the tissue was tough. It pushed back on my finger, put up some fight.

As Kevin cut, Dr. Mack explained to me that the area damaged in GA-1 is called the putamen. The putamen is wedged deep in the middle of the brain in an area known as the basal ganglia. An MRI of a brain-damaged child with GA-1 looks white in this region because the putamen is full of scar tissue from the stroke. Once scarred, it can no longer control muscle tension or reflexes, leading to twisting and repetitive movements called full body dystonia. It is not paralysis in the traditional immobile sense, but the child has no control over their body and cannot make purposeful movements, rendering them quadriplegic.

As he moved through the layers of Joe’s brain, Kevin took one-centimeter samples to be made into histology slides. Later, Dr. Eastman would cut these samples into transparently thin slices and stain them in order to see the individual cells. The leftover pieces would be liquefied and tested for glutaric acid concentration. Kevin and Dad theorized that the cells in the basal ganglia would have greater concentrations of glutaric acid than the other areas of the brain. If the putamen proved to be a sink for glutaric acid, that would explain why only this area of the brain is injured in GA-1.

A year later, Dad and Kevin have found few decisive answers in the hundreds of slides made from slices of Joe’s brain tissue. Much to their puzzlement, no traces of glutaric acid were found in any of the samples. The acid may have leeched out after death or it might have been washed away while the brain soaked in the bucket of formaldehyde. Or maybe their theory that glutaric acid pools in the putamen is completely wrong. They don’t know.

As it turns out, the single most important observation was the very first one made: Joe’s brain was huge and much too heavy for his age. Kevin thinks the size might be due to increased mitochondria in the brain. In congenital heart disease the heart is often enlarged due to abnormally high levels of mitochondria, the so-called “powerhouses” of the cell. Mitochondria produce energy in the form of ATP molecules, but when the heart cells are stressed from disease, they produce less ATP and thus less energy. To make up for the sluggish energy production, the cells make more mitochondria, which in turn enlarges the heart. This cycle has never been noted before in the brain, and Kevin is currently developing a method of counting mitochondria in brain tissue to test the new theory.

Glutaric aciduria is a complex disease. My dad, a difficult student and high school dropout, once told me that he decided to become a doctor because he would always be challenged by medicine. In that respect, glutaric aciduria has never let him down. Even after studying GA-1 intensively for nineteen years, important details like why is the putamen injured? And how does it happen? still elude him. Dissecting Joe’s brain raised more questions than it answered, but that is the nature of medicine.

Seeking Answers

While the Amish may see their sick children in a special light they, like all parents, want their kids to suffer less and lead fulfilling lives. They view science and modern medicine as a conduit to understanding God’s work and despite shunning technology in their own homes, have embraced the clinic. Nevertheless, the meeting of faith and medicine sometimes needs smoothing.

A few years ago my dad heard that the new baby in an Amish family he knew well was not gaining weight. My dad already knew what was wrong: the baby, like three of her cousins, had aldosterone deficiency. Worried that the parents hadn’t called the clinic, he made an unprompted housecall. He asked the mother how her infant daughter was doing and she admitted the baby didn’t seem right, but that “she had been praying about her.” To which my dad replied, “What kind of answer do you expect?”

Aldosterone is an essential hormone the body normally makes on its own. In children with the CYP11A2 gene mutation, the body cannot make aldosterone. Not too long ago, this was a lethal disease. Babies wasted away and died at a few months of age. Now the gene mutation causing the disease is known and the effects of that mutation on the body are well understood. Children are now diagnosed at birth and thrive on aldosterone supplements that cost pennies a day.

My dad recalls telling the young mother, “A doctor, a friend too, has walked into your house to take a few drops of blood for an inexpensive test to diagnose your baby’s illness. I can offer a simple treatment, which costs very little. Your baby will start growing and be healthy. From my point of view, that is a good answer to a prayer.”

Cases like this, and that of Ruth and Anna Rose Allgyer, make it hard to understand how nationwide newborn screening programs can be so controversial. But the testing of babies for potentially lethal genetic diseases has been mired in ethical debate ever since New York began screening babies for phenylketonuria in 1965. Over the past few decades, more diseases have been added to the battery of tests. Each state decides which diseases to screen for and how much to charge: California tests for 76 different disorders for $102; Maryland screens for 35 at a cost of $42; West Virginia only screens for 3, but the test is free.

Detractors point out the monetary costs of testing hundreds of thousands of children for diseases that only occur in about 3,000 births a year. Others squabble over which diseases should be tested for – more common disorders or the most deadly? Should lethal diseases with no known treatment options (like Tay-Sachs disease) be tested for at birth if nothing can be done? Does a disease have to be lethal to justify testing? Painful? Disfiguring? How cruel must a disease be to justify selective abortion of an affected fetus? How to avoid a dangerous slide into frivolous testing for sex or hair color? Should parents be able to refuse having their children tested? Concerns about privacy and discrimination are also raised, especially in regards to insurance companies: if the insurance company pays for the testing, should they have access to the results? And if a test is positive, should the company be able to deny the baby insurance coverage?

Most of these questions are debated in political arenas, far from the children and families affected by genetic disease. For the most part, the advantages of newborn screening, as shown in Anna Rose’s case, have overcome the ethical and political debates against testing, but the battle has been all uphill. The Amish, despite their unwavering religious convictions against technology, have accepted newborn screening and medical intervention without reservation and without wasting time and money debating any of the above questions that concern our own society so greatly. The Amish embrace genetic testing simply because it is in their children’s best interest. Why doesn’t this reasoning trump our ethical debates? What kind of answers do we expect?

The Dawn of Genomic Medicine

The clinic has changed a lot since my childhood. It’s no longer a struggling one-man-show: pediatrician Kevin Strauss, two full-time nurses and a geneticist have joined the staff. The non-profit budget, supported by small patient fees, an annual Amish and Mennonite-run auction and donations from the public, has soared to just over a million dollars a year. The building itself has expanded too; in 2001, a matching timber-frame addition doubled exam room, office and lab space. In the interests of keeping patient costs low and accessibility high, the clinic has its own in-house cardiac echo machine, hearing lab, and state of the art biochemical and genetics laboratories. All of this growth goes directly towards caring for around 800 children with 105 different genetic disorders.

The clinic labs are always busy. A new mass spectrometer donated in 1999 by Hewlett-Packard churns out glutaric acid and protein levels essential to monitoring glutaric aciduria and many other disorders. Lab tests are done at the clinic much faster and cheaper than if they were sent out elsewhere. For example, a glutaric acid test done in a matter of hours at the clinic costs a family $25. At nearby Lancaster Labs the same test takes a week and costs $300. For nearly ten years, my dad did all the lab work himself, until 1998, when the budget finally allowed him to hire a full time lab technician, Erik Puffenberger. Erik is far more than just a lab tech though; he has a doctorate in genetics from Case Western University.

Of all the changes at the clinic, perhaps nothing has had a greater impact than the completion of the Human Genome Project. In the years since Erik was hired and the human genome was sequenced, genetics machinery has gradually taken over the original clinic lab and overflowed into two additional rooms. But the clinic staff isn’t focused on the gene therapy grand prize, instead they are putting data from the Human Genome Project to practical use by focusing on what they always focus on: effective, efficient, affordable medicine. Dad and Kevin have known for years that the best weapon they have against genetic disease is early diagnosis. Erik has honed that weapon by using genomic data to design better, faster, cheaper methods of diagnosing inherited diseases.

Newborn screening used to be done using the mass spectrometer to look for chemical signatures of different diseases. For example, to diagnose glutaric aciduria you would look for high levels of glutaric acid in amniotic fluid, urine or blood. But since Erik discovered the GCDH gene mutation that causes GA-1 in 1999, he began using a gene sequencer to look for the mutation in newborns. This molecular-based system is faster and more accurate than the original mass-spec method of screening.

A gene sequencer can be used to diagnose many of the inherited diseases seen in the Amish and Mennonites, but first somebody must find the gene mutation causing the disease. A few years ago, identifying gene mutations was a PhD-worthy project, but with today’s technology looking through billions of bases of DNA for one misspelled letter is simply drudgery, perfect for a young, hungry, student worker. I graduated from college in 2005 with a degree in biology and an interest in genetics. Sure enough, I soon found myself back at the clinic, this time running the gene sequencer.

Needle in a Hayfield

The basis for all inherited disorders lurks within our genetic code. DNA is contained inside the cell nucleus on two sets of 46 chromosomes. The code consists of four chemical bases: thymine, adenine, cytosine and guanine represented by the letters T, A, C and G respectively. These letters, when grouped in sets of 3, spell out amino acids. For example, GAA is the amino acid leucine; CAG is valine; and GGG, proline. When these amino acids are strung together in long strands, they form proteins. Proteins are responsible for a myriad of functions within our bodies. Everything from our metabolism to our immune system to the very structure of our cells is regulated by or comprised of proteins.

Despite its simple four-letter code, the sheer vastness of DNA and its wealth of stored information make it extraordinarily complex. The human genome is made up of 3.2 billion T-A-G-C bases that spell out 23,000 genes. Sequencing the entire human genome was a massive 13-year undertaking that employed hundreds researchers using thousands of machines. Sequencing done at the clinic uses the same machines and techniques, but on a much smaller scale.


This is a small section of my very own DNA sequence:

tattctctgttctttcatggggaagcagatttgggtaccacccaagtattgactcacccatcaacaaccgctatgtatttcgtacattactgccagccaccatgaatttgtacggtaccataaatacttgaccacctgtagtacataaaaacccaatccacatcaaaaccccctccccatgcttacaagcaggtacagcaatcaaccctcaactatcacacatcaactgcaactcccaaagccacccctcacccactaggataccaacaaacctacccacccttaacagtacatagtacataaagccatttaccgtacatagcacattacagtcaaatcccttctcgtccccatggatgacc

These 362 bases took me eight hours in the lab over two days to sequence, five minutes to compare with the universal human sequence and 15 minutes to type out and spell check. At that rate, using a gene sequencer it would take me more than 3 lifetimes to duplicate my entire genome just once. As the cells in my body divide, they copy my DNA at a dizzying rate of 53,333,333 bases a minute or 888,888 per second, all day, everyday of my life.

Not only is DNA duplication in the body exceedingly fast, it is also astonishingly accurate. The cell’s vigilant spell checking machinery ensures that new mutations occur extremely rarely. Not all changes are bad; good ones fuel evolution. But mutations more often cause a cascade of problems that can lead to disease and sometimes, death. Most genetic disorders seen today are caused by a single mutation in the DNA sequence that occurred thousands of years ago.

So if disease-causing mutations often kill their hosts, why haven’t they died out in modern populations? Mutations, like the one that causes glutaric aciduria, persist because they are passed down through generations by carriers. Carriers have only one copy of the mutation on one set of their chromosomes. The other chromosome has the normal, non-mutated sequence, which maintains the gene’s normal function. Carriers are usually unaware that anything is wrong with their genes, unless they happen to have children with another carrier with the same mutation. When two carriers with the same mutation have children, their child has a one in four chance that the parents’ genes will combine to give them two copies of the gene mutation and, therefore, the full blown disease. The genetic dice are not always fair however; the Miller family had five children with GA-1 out of seven.

The Amish community has many GA-1 carriers due to their small gene pool: 1 in 20 Old Order Amish have one copy of the GCDH mutation. Everybody in the modern Amish community is descended from a dozen couples that first came to America from northern Europe in the 1700’s. This is known as a population bottleneck. One of these 24 founders must have been a carrier for the glutaric aciduria gene mutation and passed it down to the next generation. Common misconception holds that inbreeding is the cause of genetic disease in the Amish. The reality is that even if two people aren’t first cousins (a union frowned upon in the Amish church) they are still quite closely related genetically due to the historically limited gene pool. The Amish and Mennonite communities also have a higher incidence of genetic disease partly because their populations are closed: marriages always take place within the church community. The chances that one GA-1 carrier will marry and have children with another GA-1 carrier are much higher than in the general population.

The first key to detecting a gene mutation lies in understanding that you don’t inherit your DNA one base at a time. Rather, you get large chunks from your father that combine with large chunks from your mother to make up your own unique patchwork genome. If your parents are carriers that came from the same ancestral population, like the Amish and Mennonites do, the chunks of DNA that surround a certain gene mutation will be the same in each parent, since they originally came from the same founding person. So if you inherit one copy of a gene mutation from each parent you have also inherited large chunks of DNA surrounding the mutation that will be exactly the same on both chromosomes. These areas are known as regions of homozygosity. Our search for one faulty base out of billions begins with locating these matching regions in the genome.

This first step of locating matching homozygous regions in the genome was all but impossible until just recently, with the invention of Affymetrix’s genome scanning chips. These thin, but complex wafers of computer technology allow us to look through the entire genome in one fell swoop, searching out these regions of matching homozygous DNA. When you scan two or more patients that have the same genetic disorder, the area in which they match, the area of homozygosity around the mutation, stands out. This only narrows the search down to about 300,000 bases, still quite a hayloft, but it does help delineate a certain region on one chromosome.

The first gene mutation I discovered was for Kartagener’s syndrome, a disease that causes paralysis of the cilia lining the lungs, and somewhat bizarrely, situs inversus, or flipping of the bodily organs. Six children in a community of Amish people located in the Big Valley region of Pennsylvania had been born to two related sets of couples, all with severe respiratory problems and their heart, liver and other organs flipped onto the opposite side of their bodies. When we tested their blood with a whole genome-scanning chip, a large peak showed that a region of homozygosity on chromosome 5 was shared between all the children.

Narrowing down the field to just one area is an essential step, but chromosomes are packed with genes, several thousand on each, and this region alone contained a few hundred gene possibilities. One very interesting gene stood out, however: DNAH5, which showed high levels of expression in the lungs, indicating it performed some function there. My only drawback to sequencing the DNAH5 gene was that it was huge, some 55,000 bases long.

Genes are segmented into coding regions and non-coding regions. Coding regions are called exons, which are made up of bases that spell out amino acids. Coding regions are separated by introns, which are spacers whose bases don’t directly code for anything. DNAH5 has 90 exons, which would take an almost overwhelming amount of sequencing to decode. I hardly knew where to begin. So to start, I picked a dozen exons known to be highly variable in people of European descent, not directly an indicator of a mutation, but merely a dim light to help guide my shot in the dark. DNA sequencing starts with using the Human Genome Project databases (www.ncbi.gov) to design little bits of DNA specifically engineered to match the beginning and end of the exon of interest. These snippets, known as primers, seek out either end of the exon and match up with the DNA, specifying the string of bases to be sequenced, usually one exon, or up to 500 bases at a time.

Fluorescence-based dyes are then added to the DNA sample. The dyes are designed to adhere to their specific nucleotide in the sequence: G is black, A is green, C is blue and T is red. The gene sequencer then detects the 4 fluorescent dyes, establishes a color for each base along the strand, and draws a high peak of either black, green, blue, or red, denoting a G, A, C or T at that point. The sequence must then be checked by hand for any variants from the reference, or normal sequence established by the Human Genome Project. Variations in the code may be common changes that don’t affect the pattern of proteins, or they might be mutations.

Towards the end of sequencing the first batch of exons in DNAH5, I found something amiss on exon 27. The printout showed a red spike where there should have been a blue one: the letter was changed from C to T. Where the sequence should have read GAA-TTC-CAG-AAC, in these kids it was changed by one base to GAA-TTC-TAG-AAC. Checking the triplet amino acid code revealed the problem: CAG codes for glutamine but TAG is a stop codon. The mutation was telling the cell’s machinery to stop translating the gene at exon 27. So, the rest of the gene, some sixty exons, was lost, severely compromising the function of DNAH5 in children with Kartagener’s syndrome. I found the needle; it is small, but dreadfully sharp.

Edna

I heard Edna long before I saw her. With all the blood being drawn at the clinic, crying babies are part of the everyday ambiance. But Edna wasn’t just crying, she was screaming. And when I saw her, I nearly screamed too. Not yet 12 hours old, Edna was bright red and covered with blisters, like she’d been burned from head to toe, only she hadn’t. A letter from a local midwife said that Edna had come out of her mother’s womb bright red with her skin peeling off in sheets. From her first breath the baby girl had been screaming in pain and misery.

Edna’s mother Rebecca, an Old Order Amish woman, was exhausted and terrified: 14 years earlier she had given birth to another daughter with peeling red skin who died at 3 months of age. Back then the doctors had given her few answers and no hope. In the years since she had had seven more children. None of them were red at birth, but three had chronic bouts of skin problems. Clearly, the cause of Edna’s misery was genetic.

Initial tests showed Edna’s blood contained alarmingly high levels of eosinophils, white blood cells that are supposed to fight infection. A healthy baby will have less than 400 eosinophils per microliter of blood. Edna had over 17,000. Her immune system was going haywire and the massive overdose of blood cells was poisoning the newborn baby. She was started immediately on prednisone, a steroid that would kill the extra cells and help clear up her inflamed skin. A baby this tiny under so much stress is in danger of going into shock, so Edna was admitted to nearby Lancaster General Hospital. There a nurse spent the better part of a day washing the newborn in a soothing bath, trying to quell her misery and stop her screaming. Eventually, Edna was given a sedative and for the first time since she was born, she fell asleep.

Edna’s eosinophil counts started dropping soon after she was given her first dose of steroids and after a few days of treatment her skin started to clear up. Her red skin got paler and paler, but then she got too pale. Blood work now showed Edna was severely anemic; her red blood cell count had plummeted. The baby was no longer screaming, but ominously listless. The lymph nodes on her neck and under her arms were grossly swollen and firm to the touch. With Edna under anesthesia, a surgeon lanced the nodes and took a sample of the thick yellow ooze. Testing of the pus showed that Edna had an overwhelming septic staph infection.

The combination of haywire white blood cell counts and a sudden, massive staph infection pointed doctors towards a problem with Edna’s immune system. More blood tests revealed her immune globulins, cells that regulate the immune system, were completely out of whack. Her IgE’s, antibodies that responds to allergens, were much too high while levels of all other immune globulins were undetectably low. Further immune function tests confirmed that Edna had a Severe Combined Immune Deficiency disorder, commonly known as Bubble Boy Disease.

There are at least 10 different types of Severe Combined Immune Deficiency disorders, also known by the acronym SCID, each caused by a different gene mutation. These mutations affect the immune system in varying ways, but all render the body incapable of fighting infections. Not all forms of SCID require a person to live inside a germ-free bubble, but they are all highly lethal: 60% of SCID children die of infection before their second birthday and few live past childhood. The only hope for a child with SCID is to have a bone marrow transplant from a matching, healthy donor. The younger they are, the better their chances of survival after transplant.

Among the Amish and Mennonites, SCID is caused by mutations in six different genes. Edna’s symptoms pointed to a particular immune deficiency known as Omenn’s syndrome, but the only way to know for sure was to find her gene mutation. I was given Edna’s DNA sample on a Friday afternoon and told not to leave the lab until I found the needle that was making her sick.

In order to use the whole genome-scanning chip, you must have more than one patient to compare matching regions of homozygosity. Since we only had Edna, Erik approached her case from a different angle. He ran whole genome scans on her seven brothers and sisters, reasoning that while the kids might match up in many areas, because Edna was the only one with the full blown disease, she would be unique from her siblings in the region of the mutation. By using her brothers and sisters to eliminate large regions of the genome, Erik was left with one chunk of DNA on chromosome 11 where Edna was unique from her siblings. Erik’s ingenuity paid off: two genes called RAG1 and RAG2, known to be associated with the immune system, lay smack dab in the middle of Edna’s unique region.

I spent the weekend sequencing Edna’s RAG1 and RAG2 genes. On Sunday evening, I found Edna’s needle. RAG2 was clean, but RAG1 had a change from A to G in the second exon: Edna’s RAG1 gene had a black spike where it should have had a green one. The mutation changed the gene’s protein sequence from AAA (lysine) to GAA (glutamine). This seemingly insignificant change left baby Edna, still in the hospital, without a working immune system.

The RAG1 gene controls the formation of T cells, lymphocytes that in turn, regulate the immune system. Edna’s mutation meant she had plenty of T cells, but they were abnormal and not doing their job correctly. Her faulty T cells were telling her body to make eosinophils at an alarming rate. Then, when the foreign staphylococcus cells began invading, the malfunctioning T cells did nothing to stop the staph from colonizing Edna’s lymph nodes, leading to her massive infection. The only way to help Edna was to completely reset her immune system -- she needed a bone marrow transplant as soon as possible.

Bone marrow transplants are like any other kind of transplant: the tissue from the donor needs to match the tissue of the recipient, or the new organ will be rejected. Edna’s best bet for a bone marrow match was one of her seven brothers and sisters. This presented a very difficult problem, however. The traditional method of matching, called HLA typing, would take two weeks and cost $12,000 per person. Edna didn’t have two weeks and her dairy-farmer father didn’t have $84,000 for the testing. Ever the paragons of accessible medicine, my dad and Erik weren’t deterred. They set about figuring out a way they could do the testing themselves using the equipment in the clinic lab. HLA typing involves matching proteins on the surface of the donor and recipient’s blood cells. Erik solved the problem using genomics. Instead of looking at the proteins themselves, he went to the root and sequenced the siblings’ HLA genes, the sections of DNA that make the surface proteins. Two days and less than a thousand dollars later, he had Edna’s perfect match: her sister Mary.

Edna was still at Lancaster General Hospital, the facility nearest to the clinic, but my dad’s old stomping grounds, Children’s Hospital of Philadelphia, had the best bone marrow transplant team in the state. Edna was taken by ambulance (the Amish refuse helicopters under any circumstance) to Philadelphia for evaluation. When dad told Dr. Nancy Bunin, head of the bone marrow transplant team, that Erik had already used DNA sequencing to determine that Edna’s sister Mary was a perfect donor match, Bunin was speechless. Nobody had ever thought to sequence the HLA genes to screen for potential donors before. Dr. Bunin offered to do Mary’s HLA typing for free, just to test the new technique and confirm that she was indeed a perfect match.

Even with the cheap HLA typing, Edna’s parents were still facing a daunting $350,000 hospital bill for a bone marrow transplant. If they sold their house, their livestock, their entire farm and if their entire church chipped in, they still wouldn’t have enough cash to cover the bill. Dr. Bunin, intrigued with Edna’s case, used her clout to pull some strings. She convinced hospital administrators to let her do Edna’s transplant for free. At 62 days of age, Edna became the youngest person ever to have a bone marrow transplant at the Children’s Hospital of Philadelphia. She is also one of the very first people to be diagnosed, treated and cured from start to finish, using genomic medicine.

I saw Edna again almost exactly one year from the date of her bone marrow transplant. She is now a robustly healthy one year old. Her mother marveled that Edna was the only one of her kids who didn’t get sick at all during the winter. I also got to meet Mary, Edna’s saving grace. Mary is now three years old and still eyes my dad and all doctors suspiciously. I couldn’t help but notice Edna had big blue eyes while Mary’s were dark brown. The sisters may not have inherited the same eye color, but Edna owes her life to her sister’s compatible HLA genes.

Edna’s case has come full circle. My dad dug through the closets at Hershey Medical Center, where Edna’s sister Anna Ruth died fourteen years ago and found a tissue sample embedded in plastic-like paraffin. Back at the clinic Erik dissolved the paraffin, found some of Anna Ruth’s DNA in the old tissue and tested it for Edna’s gene mutation. Sure enough, Anna Ruth had died from Omenn’s syndrome. What was a hopeless case all those years ago now has a happy ending through genomic medicine.

A few weeks after Edna’s transplant, Dr. Bunin and her bone marrow team drove down from Philadelphia to spend the day at the clinic. They came to see genomic medicine in action. Impressed with the speed of Edna’s diagnosis and creativity involved in matching her sister as a perfect donor, Dr. Bunin said, “We had to come and see how you did it. We couldn’t have done that at CHOP.”

I sat in on the meeting with the transplant team, curious about why our tiny clinic was using genomic medicine while the Children’s Hospital of Philadelphia was not. CHOP certainly had the money, the technology and the manpower to do it. At the meeting my dad said, “Children’s is one of the best, biggest, and richest hospitals in the country. But therein lies the problem. You’re too big.”

Genomic medicine is personalized; it focuses on the unique genome of the individual patient. By its very nature genomic medicine is small medicine and small medicine is best practiced at a small clinic. The clinic’s size allows for flexibility and care plans are easily adapted to each child’s case. Medicine at the clinic was already personalized medicine before genomics came along; the new technologies are simply another tool we use to improve care.

Not so long ago, all medicine was small medicine. My grandfather knew his patients personally, not just through their medical charts, and they knew him. How many doctors today know their patients? And how many patients know their doctors? My mother remembers making housecalls with her dad. How many doctors nowadays make housecalls? At some point in the past fifty years, the patient-doctor relationship has completely broken down. Healthcare is no longer about people; in the 21st century, healthcare is about money.

The exorbitant expense of HLA typing has no medical reason, but there is a business reason: supply and demand. Only a handful of companies do HLA typing and they can charge whatever they want for the service. Before Erik invented the HLA sequencing technique, patients with SCID, lymphoma or leukemia had no choice but to cough up $12,000 to test every potential bone marrow donor until they found a match. For those fortunate to have insurance, this is usually only a minor roadblock, but for people like Edna’s parents, it is expensive enough to potentially stop a lifesaving transplant altogether. Appalling as this business-based medicine is, it is not at all unusual. Betaine, an amino acid used to treat MTHFR deficiency, a genetic disorder seen among the Amish, costs clinic families $150 a year because we purchase it directly from SIGMA Chemical. If these families were to get betaine from a hospital pharmacy the yearly bill would amount to more than $10,000 per child, about $5,000 of which is billed for “preparing the drug”. Ridiculous, considering that “preparing the drug” in this case entails diluting the liquid betaine with water and shaking thoroughly.

Such mark-ups, called cost-plus billing, are common practice at hospitals because bills are designed to be paid by insurance companies. Paying bills out of pocket is often impossible; people must have health insurance to survive the system. Not everybody does: as many as 50 million Americans do not have adequate medical coverage and lack of insurance is the seventh leading cause of death in this country. The mounting costs of healthcare are an issue for millions of people, not just the Amish. It is a daunting problem, but it is a problem that can be solved. The Clinic For Special Children does it everyday.

In many ways it is a blessing most of the clinic’s patients don’t have insurance. My mother, who handles the business side of the clinic, is always thankful not to have deal with insurance companies. They never fail to give her the run-around and their decisions are often clearly not based on medical knowledge. A few years ago, a non-Amish patient needed an updated echocardiogram to track the progression of a heart abnormality. His insurance company refused to pay for the test, saying he had already had an echo previously and he shouldn’t need another. So the clinic bought its own echo machine and recruited a cardiologist to come to the clinic on his day off to run it. Now patients can have echoes as often as they need them, for $35 a pop. In other cases where costs are so high that they limit treatment options, the clinic staff get creative, often inventing completely new ways of delivering care, as in Edna’s case. Because they are always seeking new ways of making care more efficient and more affordable, the clinic staff easily embraces changing technology. So when the Human Genome Project was completed, they began using genomics without hesitation.

At the meeting, my dad also asked the transplant team, “When was the last time any of you worked with a geneticist on a case?” Nobody on the CHOP team ever had, until Erik. “That’s the other secret of why genomic medicine at the clinic works: collaboration”, dad said.

Erik’s ability to take raw data from the Human Genome Project website and apply it to the everyday practice of diagnosing and treating patients is key to the clinic’s success in genomics. The jump from gene to disease is one of the most poorly understood relationships in medicine, but when Erik combines his gene expertise with the doctors’ in depth understanding of disease, the team is often unstoppable. My dad emphasizes, “I could not do my job without Erik”, and yet, as demonstrated at the CHOP meeting, this kind of collaboration is all too rare.

Translating freely between cold science and effective patient care represents a new paradigm in medicine where research has a direct impact on disease diagnosis and treatment. At present, less than 5% of the National Institute of Health’s total funding grants are awarded to research geared towards patient care. As my dad says, “most research these days does not require doctors to shake the hand of the patient whose disease they are studying.”

I sat in on the CHOP meeting next to Daniel, Edna’s father. As the doctors at the round table talked, we both frantically scribbled down notes. During a break Daniel and I chatted about Edna’s recovery, his other kids and when he’d start planting his fields with corn to feed his dairy cows. At one point he looked from his notes to mine and laughed, “I don’t know what any of these big words mean, but I know they all helped save Edna, so I can’t get enough of them!”

When genomic medicine is at its best, it works as it did for Edna. First Edna’s genes pointed her doctors to a specific diagnosis and then her siblings’ genes spelled out the best course of treatment. But genomics aren’t always so pat; answers for the Yoder family have so far remained elusive. Last winter, I sequenced every exon in 34 different genes on chromosome 8 looking for the one misspelling that was causing Emma, Ivan and Jacob’s mysterious disease, but came up empty handed. The work continues and hopefully someday soon Dad, Kevin and Erik will be able to sit down with the Yoders and give them some answers to the mystery of their children’s unknown illness. I have a feeling though, no matter what we can teach them about their genes with our fancy equipment, this family has already taught us far more valuable lessons about life, love and compassion.

To outsiders the Amish may seem to be a throwback to simpler times. As somebody who has grown up among the plain cultures, I can say there is nothing simple about the Amish or their way of life. They are modern people who choose to live in a way that is very different from our own high tech, high speed, highly consumptive society. Being different is never easy, but with great faith and perseverance the Amish have been able to maintain a way of life that keeps them close to their God, the earth, and their community. I have found them to be compassionate, wise and altogether remarkable people, especially in regards to their “special children”.

Visitors to the clinic often comment on what they see as a stark contrast between modern medicine and plain culture and I can attest that running a gene sequencer while watching our neighbor plow his field with a team of mules outside my window was a surreal experience. But the clinic exists because of the plain people and their beliefs, not in spite of them. The Amish are practical people who demand practical medicine. While the rest of the world was focused on gene therapy and the improbable goal of ridding mankind of disease, the Amish and their doctors were focused on providing the best possible care for sick children.

In an essay entitled “Through My Window” published in Pediatrics in 1994 my dad recalled the wise words of an Amish man spoken as he sat on a bed beside his grandson, who had just recently passed away from an incurable genetic disease: “We will be glad if you can learn to help these children, but such children will always be with us. They are God’s gifts. They are important to all of us. Special children teach a family to love. They teach a family how to help others and how to accept the help of others.”

I believe there is much the medical community, and our own society, can learn from the Amish and their special children.











Genomic Medicine: An Epilogue

Technology at the clinic is always evolving. Last summer the clinic bought a light-cycler machine for diagnostic testing. A light-cycler uses the unique melting points of gene mutations to diagnose up to 96 different genetic diseases all at once, quickly and accurately. A DNA sample with the glutaric aciduria, Kartagener’s or Omenn’s mutation will melt at a lower temperature than a DNA sample from a child without the mutation. So now, instead of painstakingly testing a newborn baby’s DNA for mutations one disease at a time using a gene sequencer, a sample can be loaded onto the light-cycler and be tested for dozens of disorders all at once. Best of all, testing takes less than two hours and costs $10 per child. The light-cycler picked up its first Omenn’s syndrome baby in March of 2008 and he is well on his way to breaking Edna’s record for the youngest bone marrow transplant.